CAGE library preparation was adapted from Takahashi et al. (2012) and modified to work with Illumina GA IIx sequencers. Five micrograms of total RNA was reverse transcribed with RT random N15 primer (5′-AAGGTCTATCAGCAGNNNNNNNNNNNNNNNC-3′), PrimeScript Reverse Transcriptase in the presence of 0.132 M trehalose and 0.66 M sorbitol. The sample was cap-trapped and a specific linker, containing a 3-bp recognition site and the type III restriction-modification enzyme EcoP15I, (5′-PhosCTGCTGXXXCTGTAGAACTCTGAACCTGTCGGTGG-3′) for both N6 (5′-CCACCGACAGGTTCAGAGTTCTACAGXXXCAGCAGNNNNNNPhos-3′) and GN5 (5′-CCACCGACAGGTTCAGAGTTCTACAGXXXCAGCAGGNNNNNPhos-3′), was ligated to the single-strand cDNA. The priming of the second strand was made with specific primer (5′-BioCCACCGACAGGTTCAGAGTTCTACAG-3′). After second strand synthesis and cleavage with EcoP15I, another linker (1:1 mix of Upper oligonucleotide; 5′-PhosNNTCGTATGCCGTCTTCTGCTTG-3′ and Lower oligonucleotide; 5′-CAAGCAGAAGACGGCATACGA-3′) was ligated. Purified cDNA was amplified with 1 μM each, forward (AATGATACGGCGACCACCGACAGGTTCAGAGTTC) and reverse (CAAGCAGAAGACGGCATACGA) primers with 15 to 18 PCR cycles. PCR products were purified and concentration was adjusted to 10 nM. The CAGE libraries were clustered to GA IIx flowcell at a final concentration of 5 pM, following the Illumina cluster generation protocol kit v.4 and then sequenced with Illumina GA IIx 36 cycles single-read run operation program using specific sequencing primer (CGGCGACCACCGACAGGTTCAGAGTTCTACAG), following the Illumina sequence protocol. (Source: Nepal et al. 2013)